SGN Marker solcap_snp_sl_49230

SGN-M23893

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69097)
Chromosome
5
Position
18.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65460)
Chromosome
5
Position
21.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60224)
Chromosome
5
Position
2.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGAAGGAATCATGATATGGTGGTTGAAATGGCGGAGATGTTGGTGAAG
  
3' flanking region
CGTGGGGGACGGAGTTAGGGACACCACCAGAAATGTGTTCGAGCATGGCA
SNP nucleotide
AG
SNPdb format
GGAGAAGGAATCATGATATGGTGGTTGAAATGGCGGAGATGTTGGTGAAG[A/G]
CGTGGGGGACGGAGTTAGGGACACCACCAGAAATGTGTTCGAGCATGGCA
  
Genomic location of solcap_snp_sl_49230  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23893 marker 23893
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)