SGN Marker solcap_snp_sl_49312

SGN-M23903

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73194)
Chromosome
2
Position
35.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60234)
Chromosome
2
Position
36.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGGAACCTGGATTCTCGTGGATCATGAAGATGATGATTTTTAGTTCTCT
  
3' flanking region
TCGAGCAAAAATATAGATCTTAAATTTATGAACGAACAGAAACAAAAATA
SNP nucleotide
AG
SNPdb format
ATGGAACCTGGATTCTCGTGGATCATGAAGATGATGATTTTTAGTTCTCT[A/G]
TCGAGCAAAAATATAGATCTTAAATTTATGAACGAACAGAAACAAAAATA
  
Genomic location of solcap_snp_sl_49312  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23903 marker 23903
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)