SGN Marker solcap_snp_sl_49443

SGN-M23911

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69101)
Chromosome
2
Position
61.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60242)
Chromosome
2
Position
38.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGAGAGGCTACTGAGCATGAGAACTACTGCAGCCATAGTTGGTCTATC
  
3' flanking region
CCAATATTTTCTTGAACGCACAATAAGGCAATGTGGACGTATCTCTTGAT
SNP nucleotide
AG
SNPdb format
AGAGAGAGGCTACTGAGCATGAGAACTACTGCAGCCATAGTTGGTCTATC[A/G]
CCAATATTTTCTTGAACGCACAATAAGGCAATGTGGACGTATCTCTTGAT
  
Genomic location of solcap_snp_sl_49443  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23911 marker 23911
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)