SGN Marker solcap_snp_sl_49505

SGN-M23918

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73206)
Chromosome
2
Position
44.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65465)
Chromosome
2
Position
90.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60249)
Chromosome
2
Position
39.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATACTGTATTTGATGTTGACCATGACAAAGAGAGAGCACAACAGTGTGG
  
3' flanking region
CTTGGACCTAATGGATTCAGCTTTGATGGAGCAGATGCTGCCGGAGTTGA
SNP nucleotide
AT
SNPdb format
GATACTGTATTTGATGTTGACCATGACAAAGAGAGAGCACAACAGTGTGG[A/T]
CTTGGACCTAATGGATTCAGCTTTGATGGAGCAGATGCTGCCGGAGTTGA
  
Genomic location of solcap_snp_sl_49505  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23918 marker 23918
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)