SGN Marker solcap_snp_sl_49576

SGN-M23924

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65467)
Chromosome
2
Position
95.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60255)
Chromosome
2
Position
39.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGCTCGTCATTATCCACTTTACTAAAAAGAAGCTTCTCAATGGCAGGTC
  
3' flanking region
GAAATCAGTCAAACGCTTCTGCTTTTCTGTGTAAGGGAAATATACTGACT
SNP nucleotide
TG
SNPdb format
GTGCTCGTCATTATCCACTTTACTAAAAAGAAGCTTCTCAATGGCAGGTC[T/G]
GAAATCAGTCAAACGCTTCTGCTTTTCTGTGTAAGGGAAATATACTGACT
  
Genomic location of solcap_snp_sl_49576  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23924 marker 23924
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)