SGN Marker solcap_snp_sl_49669

SGN-M23933

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73212)
Chromosome
2
Position
46.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69114)
Chromosome
2
Position
68.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65473)
Chromosome
2
Position
96.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60264)
Chromosome
2
Position
40.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAAACTTCAGCAACCGTTCTCGATTGGGCTATGGTTGAAATGATGAGAA
  
3' flanking region
CCCTAATGTTATGGAGAAGGCACAAACAGAATTGAGAAGAATCCTCAAAG
SNP nucleotide
AG
SNPdb format
TGAAACTTCAGCAACCGTTCTCGATTGGGCTATGGTTGAAATGATGAGAA[A/G]
CCCTAATGTTATGGAGAAGGCACAAACAGAATTGAGAAGAATCCTCAAAG
  
Genomic location of solcap_snp_sl_49669  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23933 marker 23933
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)