SGN Marker solcap_snp_sl_49990

SGN-M23950

Synonyms  
SGN-U576696_snp60922
SGN-U576696_snp60922_solcap_snp_sl_49990
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60281)
Chromosome
2
Position
41.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAGAGAAAGACAAGGTAACAGTAGGTGAAGAAGAGATTAAAAGGAAGAC
  
3' flanking region
CTCCTTATTGAAAACATGTCTATTAAGTTAGAGGAAATGGAAAGATTTGC
SNP nucleotide
TG
SNPdb format
ATAGAGAAAGACAAGGTAACAGTAGGTGAAGAAGAGATTAAAAGGAAGAC[T/G]
CTCCTTATTGAAAACATGTCTATTAAGTTAGAGGAAATGGAAAGATTTGC
  
Genomic location of solcap_snp_sl_49990  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23950 marker 23950
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)