SGN Marker solcap_snp_sl_50495

SGN-M24000

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73255)
Chromosome
1
Position
44.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60331)
Chromosome
1
Position
68.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTCACCTGAGAACTTCCCATCACTGAAACCTCCATAATTTTCCTCTGAA
  
3' flanking region
CTGAAATATAACCAGAAAAATTTGGGCGTTTTGTCAGATAAACAAATTCT
SNP nucleotide
AT
SNPdb format
ATTCACCTGAGAACTTCCCATCACTGAAACCTCCATAATTTTCCTCTGAA[A/T]
CTGAAATATAACCAGAAAAATTTGGGCGTTTTGTCAGATAAACAAATTCT
  
Genomic location of solcap_snp_sl_50495  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24000 marker 24000
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)