SGN Marker solcap_snp_sl_5050

SGN-M24001

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73256)
Chromosome
5
Position
42.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69146)
Chromosome
5
Position
49.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65505)
Chromosome
5
Position
51.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60332)
Chromosome
5
Position
5.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTTTCAAAAGCTGCTGCTGAAGCAAGGAAAAAATCGAAAATTCTTCAG
  
3' flanking region
CAGTGGTGAGAAACAAAGAACCTTACATTCTTGAAACAAATAGCAGTTTA
SNP nucleotide
TC
SNPdb format
ATGTTTCAAAAGCTGCTGCTGAAGCAAGGAAAAAATCGAAAATTCTTCAG[T/C]
CAGTGGTGAGAAACAAAGAACCTTACATTCTTGAAACAAATAGCAGTTTA
  
Genomic location of solcap_snp_sl_5050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24001 marker 24001
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)