SGN Marker solcap_snp_sl_5054

SGN-M24008

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69149)
Chromosome
5
Position
49.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65508)
Chromosome
5
Position
51.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60339)
Chromosome
5
Position
6.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGGCGAAAAGAAGAGTGATTGAAATGAAAATGGTTTGCGAAACAATGAA
  
3' flanking region
GTGGAGAGAAGAGGGAAGAAGGAATTTCTCATAGATTTAATAGACGAAAA
SNP nucleotide
AG
SNPdb format
AGGGCGAAAAGAAGAGTGATTGAAATGAAAATGGTTTGCGAAACAATGAA[A/G]
GTGGAGAGAAGAGGGAAGAAGGAATTTCTCATAGATTTAATAGACGAAAA
  
Genomic location of solcap_snp_sl_5054  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24008 marker 24008
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)