SGN Marker solcap_snp_sl_50775

SGN-M24024

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73267)
Chromosome
5
Position
39.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69158)
Chromosome
5
Position
47.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65517)
Chromosome
5
Position
48.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60355)
Chromosome
5
Position
5.70 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CATAGGAAGTCGCCGAGTCAAAGGTAGTAGTAGAAAATGATGATAACAAT
  
3' flanking region
CTAGTAGCACACAGACACTGACCAGACACAAGAGTATTCGGTTGAGTGGC
SNP nucleotide
AG
SNPdb format
CATAGGAAGTCGCCGAGTCAAAGGTAGTAGTAGAAAATGATGATAACAAT[A/G]
CTAGTAGCACACAGACACTGACCAGACACAAGAGTATTCGGTTGAGTGGC
  
Genomic location of solcap_snp_sl_50775  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24024 marker 24024
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)