SGN Marker solcap_snp_sl_50845

SGN-M24034

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69163)
Chromosome
5
Position
49.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65522)
Chromosome
5
Position
51.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60365)
Chromosome
5
Position
6.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAGACCGCGCATCAGTCATTCTAAAAAGGTTCAAATTTCTGAGGGTGTT
  
3' flanking region
GATTTTGAATTCACTATCATTGATTCTTTCCCACAAGAATTGATCCTTTT
SNP nucleotide
AG
SNPdb format
ATAGACCGCGCATCAGTCATTCTAAAAAGGTTCAAATTTCTGAGGGTGTT[A/G]
GATTTTGAATTCACTATCATTGATTCTTTCCCACAAGAATTGATCCTTTT
  
Genomic location of solcap_snp_sl_50845  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24034 marker 24034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)