Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_50895

SGN-M24044

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73278)
Chromosome
5
Position
42.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69166)
Chromosome
5
Position
50.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65524)
Chromosome
5
Position
52.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60375)
Chromosome
5
Position
6.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGACCAAGTTGTGGGTAGCTGAAGGGTTTGTACAAGCAAACAACGAAAA
  
3' flanking region
GGACAAGAAGATACCGCACAAGGTTTCTTGGACGATCTTATTGGTAGGAA
SNP nucleotide
AT
SNPdb format
ATGACCAAGTTGTGGGTAGCTGAAGGGTTTGTACAAGCAAACAACGAAAA[A/T]
GGACAAGAAGATACCGCACAAGGTTTCTTGGACGATCTTATTGGTAGGAA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_50895  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24044 marker 24044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)