SGN Marker solcap_snp_sl_50902

SGN-M24048

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73281)
Chromosome
5
Position
42.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69167)
Chromosome
5
Position
50.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65525)
Chromosome
5
Position
52.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60379)
Chromosome
5
Position
6.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGGGGCAATGTAGCCTATATTTCCTCTCACTACTGTGCTAAGATGGGTT
  
3' flanking region
GATCAAGCTCGGGCATTGTCTTAGATATTCCAAAATCAGTAATTTTTGGC
SNP nucleotide
AT
SNPdb format
CAGGGGCAATGTAGCCTATATTTCCTCTCACTACTGTGCTAAGATGGGTT[A/T]
GATCAAGCTCGGGCATTGTCTTAGATATTCCAAAATCAGTAATTTTTGGC
  
Genomic location of solcap_snp_sl_50902  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24048 marker 24048
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)