SGN Marker solcap_snp_sl_5092

SGN-M24051

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73282)
Chromosome
5
Position
45.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69168)
Chromosome
5
Position
53.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60382)
Chromosome
5
Position
7.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTGCTACCCAAAATTTTAACTTTATTTGCAAGAGTCTCAGTGTGTGATG
  
3' flanking region
TTCATCAAGTGCATCATTGTTCCTATCTCCACATAGCTCATCCTGCACAC
SNP nucleotide
AT
SNPdb format
CTTGCTACCCAAAATTTTAACTTTATTTGCAAGAGTCTCAGTGTGTGATG[A/T]
TTCATCAAGTGCATCATTGTTCCTATCTCCACATAGCTCATCCTGCACAC
  
Genomic location of solcap_snp_sl_5092  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24051 marker 24051
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)