SGN Marker solcap_snp_sl_50925

SGN-M24052

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73283)
Chromosome
5
Position
43.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69169)
Chromosome
5
Position
51.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65526)
Chromosome
5
Position
53.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60383)
Chromosome
5
Position
6.57 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTGCTGATGTTGATGATATTCCACCTATCATTGGAATTCAAGATTTTT
  
3' flanking region
TAGAGAGTTTAGTGTTGAATCTAAAAAATTATGGTATCTTGCTGGTCCAG
SNP nucleotide
TG
SNPdb format
TGTTGCTGATGTTGATGATATTCCACCTATCATTGGAATTCAAGATTTTT[T/G]
TAGAGAGTTTAGTGTTGAATCTAAAAAATTATGGTATCTTGCTGGTCCAG
  
Genomic location of solcap_snp_sl_50925  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24052 marker 24052
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)