SGN Marker solcap_snp_sl_50932

SGN-M24053

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73284)
Chromosome
5
Position
43.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60384)
Chromosome
5
Position
6.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTAATGCCAGTGAAAAGTCTACTTCCACTTCTCCTGTGGATCTATTAGG
  
3' flanking region
TTGGCTAACTATGCGTCAGATGATGAGGATGACAATGAAATCCAGAGTTC
SNP nucleotide
TC
SNPdb format
GTTAATGCCAGTGAAAAGTCTACTTCCACTTCTCCTGTGGATCTATTAGG[T/C]
TTGGCTAACTATGCGTCAGATGATGAGGATGACAATGAAATCCAGAGTTC
  
Genomic location of solcap_snp_sl_50932  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24053 marker 24053
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)