SGN Marker solcap_snp_sl_5095

SGN-M24056

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65527)
Chromosome
5
Position
60.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60387)
Chromosome
5
Position
8.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGTTATTGAAGAACAGTTCTTCAGCATTTTCAAATCTGGTGGCAGAATT
  
3' flanking region
TTGCGGAGATCATCCAAGGGGTTAACCTAAAAGCATAGCACATTTGATAG
SNP nucleotide
TC
SNPdb format
CGGTTATTGAAGAACAGTTCTTCAGCATTTTCAAATCTGGTGGCAGAATT[T/C]
TTGCGGAGATCATCCAAGGGGTTAACCTAAAAGCATAGCACATTTGATAG
  
Genomic location of solcap_snp_sl_5095  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24056 marker 24056
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)