SGN Marker solcap_snp_sl_50974

SGN-M24059

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73286)
Chromosome
5
Position
45.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69170)
Chromosome
5
Position
52.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65528)
Chromosome
5
Position
53.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60390)
Chromosome
5
Position
7.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAATAGCATGATTATGCTTGCACTGGTAAACATGTAGCTTCTTTTAATCT
  
3' flanking region
ACAATAAATACCATTTTTTTGGTTTGGTTGGTCTTTGGAGTAAATTATGG
SNP nucleotide
TG
SNPdb format
CAATAGCATGATTATGCTTGCACTGGTAAACATGTAGCTTCTTTTAATCT[T/G]
ACAATAAATACCATTTTTTTGGTTTGGTTGGTCTTTGGAGTAAATTATGG
  
Genomic location of solcap_snp_sl_50974  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24059 marker 24059
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)