SGN Marker solcap_snp_sl_51094

SGN-M24067

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73293)
Chromosome
5
Position
47.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69174)
Chromosome
5
Position
53.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65532)
Chromosome
5
Position
56.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60398)
Chromosome
5
Position
8.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTGAATTTGAAATGTTGATTCTTGATCTGGCATAACACTGAAATCTTG
  
3' flanking region
ATTAGTGGTTGCAGTGATTGCTCTGGTTTGGTACATAGCGCTTGGAACAA
SNP nucleotide
TG
SNPdb format
TGTTGAATTTGAAATGTTGATTCTTGATCTGGCATAACACTGAAATCTTG[T/G]
ATTAGTGGTTGCAGTGATTGCTCTGGTTTGGTACATAGCGCTTGGAACAA
  
Genomic location of solcap_snp_sl_51094  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24067 marker 24067
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)