SGN Marker solcap_snp_sl_51098

SGN-M24068

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69175)
Chromosome
5
Position
53.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65533)
Chromosome
5
Position
56.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60399)
Chromosome
5
Position
8.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAGCCAATCCCATCTTATAAACAAACAATGGTCCAAGAATCCCTCTAAC
  
3' flanking region
AAACTATACAACATATAAAATAGTGGTGACAATTTATCATACAATTCAGC
SNP nucleotide
AC
SNPdb format
AAAGCCAATCCCATCTTATAAACAAACAATGGTCCAAGAATCCCTCTAAC[A/C]
AAACTATACAACATATAAAATAGTGGTGACAATTTATCATACAATTCAGC
  
Genomic location of solcap_snp_sl_51098  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24068 marker 24068
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)