SGN Marker solcap_snp_sl_51106

SGN-M24071

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60402)
Chromosome
5
Position
8.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGCAGTGATGGTGATGGTGGTGGAGTGAGGAGAAGTGGTGGGCTTAGT
  
3' flanking region
TCAGAGCTGTTGACCGAGAGCCTATAAAAGAAAGGGATATGATGAATGGC
SNP nucleotide
TG
SNPdb format
GTAGCAGTGATGGTGATGGTGGTGGAGTGAGGAGAAGTGGTGGGCTTAGT[T/G]
TCAGAGCTGTTGACCGAGAGCCTATAAAAGAAAGGGATATGATGAATGGC
  
Genomic location of solcap_snp_sl_51106  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24071 marker 24071
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)