SGN Marker solcap_snp_sl_51177

SGN-M24087

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60418)
Chromosome
5
Position
12.11 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAAAACAACATACCTTCTAAACAATAACAATCGAATCATAAACGAGTTA
  
3' flanking region
AACATCGATTTGCAGCCAATGACAAGTCAAAATGATCTCAGACAGTTTAT
SNP nucleotide
AC
SNPdb format
GAAAAACAACATACCTTCTAAACAATAACAATCGAATCATAAACGAGTTA[A/C]
AACATCGATTTGCAGCCAATGACAAGTCAAAATGATCTCAGACAGTTTAT
  
Genomic location of solcap_snp_sl_51177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24087 marker 24087
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)