SGN Marker CT260

SGN-M241

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT260 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTATGGAAACATTTTTAAACACAATATGATATATATTGTACAACAAAACATTACATCATGACCAACCATT
CATAGTACGTAAATGAATGGCTTTATTCATACTTGTTACAAGCAAAGGGCCTTAATTAAGTAGCAAGATTATTATTATCTTGTCACTTAA
TTTCAAAAGGTTACCATAATAATAAATACACATAATTAAGCACTAATTAATTATTTAATTTTGAGTCTGGGCAGCAACATATTCTTCATA
AGAGCAGCAGTATTTTTCTCACCGGAAGAATGGAATCTGTTACCAAGCATGCAATTGTGATTAAAATCATGGGTCGTACGGGATCCATGG
GGCAGGTGACTCAGGTGAGAGTCAAGTTTCTTGATGACCAAAACAGGTTTATCATGAGAAATGTCAAGGGACCAGTCAGAGAGGGTGATA
TTCTCACACTGTTGGAATCTGACAAGGAAGCCAAGAGGTTGCGT
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1435991.2e-3280 (16.2% of RFLP seq)+
SGN-U1603342.5e-52163 (33.0% of RFLP seq)+
SGN-U1436019.9e-89212 (42.9% of RFLP seq)+
SGN-U1603321.7e-96193 (39.1% of RFLP seq)+
SGN-U1436001e-106222 (44.9% of RFLP seq)+
SGN-U1431674e-134256 (51.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8715)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8714)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8716)
Chromosome
10
Position
43.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT260 was used as an overgo probe on plate 14 [well A9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P123N10,   P288E11,   P154P09,   P014C09,   P139C11,   P329N10,   P223A11,   P043C20,   P212M19,   P006H15,   P031E22,   P302I08,   P253B18,   P066L04,   P174P12,   P025M03,   P073J03,   P301D15,   P134O19,   P011G05,   P259N14,   P333M10,   P268K15,   P135H07,   P079F11,   P170L22,   P149G20,   P066D12,   P234C21,   P312P11,   P134N11,   P003G10,   P226G20,   P328J16,   P316C19,   P025D18,   P169H21,   P056M20,   P313N08,   P030C15,   P282K16,   P254A20,   P223M24,   P059P01,   P253I01,   P194O14,   P171G14,   P180L14,   P297G04,   P158E21,   P013N17,   P238I06,   P050L01,   P033D17,   P173J02,   P224M20,   P034N11,   P225A23

 Overgo Sequences

A sequence
GAAATGTCAAGGGACCAGTCAGAG
B sequence
GTGAGAATATCACCCTCTCTGACT
AB sequence
GAAATGTCAAGGGACCAGTCAGAGAGGGTG
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTATGGAAACATTTTTAAACACAATATGAT
ATATATTGTACAACAAAACATTACATCATGACCAACCATTCATAGTACGT
AAATGAATGGCTTTATTCATACTTGTTACAAGCAAAGGGCCTTAATTAAG
TAGCAAGATTATTATTATCTTGTCACTTAATTTCAAAAGGTTACCATAAT
AATAAATACACATAATTAAGCACTAATTAATTATTTAATTTTGAGTCTGG
GCAGCAACATATTCTTCATAAGAGCAGCAGTATTTTTCTCACCGGAAGAA
TGGAATCTGTTACCAAGCATGCAATTGTGATTAAAATCATGGGTCGTACG
GGATCCATGGGGCAGGTGACTCAGGTGAGAGTCAAGTTTCTTGATGACCA
AAACAGGTTTATCATGAGAAATGTCAAGGGACCAGTCAGAGAGGGTGATA
TTCTCACACTGTTGGAATCTGACAAGGAAGCCAAGAGGTTGCGT
Genomic location of CT260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D241 marker 241
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)