SGN Marker solcap_snp_sl_51459

SGN-M24139

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73343)
Chromosome
5
Position
48.41 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69210)
Chromosome
5
Position
54.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65564)
Chromosome
5
Position
67.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60470)
Chromosome
5
Position
58.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCCCGTAGATGTCACATTCGCGGTAAAATTGTCTGAATGAGTGGGCGTA
  
3' flanking region
AGAGTGTCTTGGTAACCGGTTATGGTGCACCGGTAGACGGCAGCTAAGTC
SNP nucleotide
AG
SNPdb format
GTCCCGTAGATGTCACATTCGCGGTAAAATTGTCTGAATGAGTGGGCGTA[A/G]
AGAGTGTCTTGGTAACCGGTTATGGTGCACCGGTAGACGGCAGCTAAGTC
  
Genomic location of solcap_snp_sl_51459  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24139 marker 24139
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)