Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_51462

SGN-M24141

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73344)
Chromosome
1
Position
40.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69212)
Chromosome
1
Position
31.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65566)
Chromosome
1
Position
43.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60472)
Chromosome
1
Position
19.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTGACCGCTACAGACTTGACGTAGTGAAAATTAAATCCCAACACCCCT
  
3' flanking region
CCGCTGACAAGGGAAATAGCAACAACCAACTCCCCATATTTACTAGTACG
SNP nucleotide
AC
SNPdb format
AGTTGACCGCTACAGACTTGACGTAGTGAAAATTAAATCCCAACACCCCT[A/C]
CCGCTGACAAGGGAAATAGCAACAACCAACTCCCCATATTTACTAGTACG
  
Genomic location of solcap_snp_sl_51462  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24141 marker 24141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)