SGN Marker solcap_snp_sl_51532

SGN-M24161

Synonyms  
SGN-U571087_snp344
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73356)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69219)
Chromosome
2
Position
1.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60492)
Chromosome
2
Position
20.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATGTTCTCAATCTAACTTATCAATCATTTACAATTTAAATCTTAAATTC
  
3' flanking region
TTTCTTCTGAACCTAAACGATAATCTTCTTACTTCTTCAATAAACCTCAG
SNP nucleotide
AG
SNPdb format
TATGTTCTCAATCTAACTTATCAATCATTTACAATTTAAATCTTAAATTC[A/G]
TTTCTTCTGAACCTAAACGATAATCTTCTTACTTCTTCAATAAACCTCAG
  
Genomic location of solcap_snp_sl_51532  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24161 marker 24161
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)