SGN Marker solcap_snp_sl_51601

SGN-M24174

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65577)
Chromosome
5
Position
61.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60505)
Chromosome
5
Position
20.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGCCTCTGAGAGATTCTAACCCTGGTAATACAGCAAGTACGACTGGTTA
  
3' flanking region
GCAGTTCCTGGCATGATGCAAGTAATAGCTACCACTAGTGGAGATAGACC
SNP nucleotide
TC
SNPdb format
ATGCCTCTGAGAGATTCTAACCCTGGTAATACAGCAAGTACGACTGGTTA[T/C]
GCAGTTCCTGGCATGATGCAAGTAATAGCTACCACTAGTGGAGATAGACC
  
Genomic location of solcap_snp_sl_51601  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24174 marker 24174
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)