SGN Marker solcap_snp_sl_51792

SGN-M24191

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60522)
Chromosome
7
Position
55.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATGTCCATTGTCTTTGAGTCTATGTTCGATATACTCAAACAGTCCACC
  
3' flanking region
CTTCCTTCAAGATAGAAAGGGGATTCTGGAATCAAACAGCAGTCAACATC
SNP nucleotide
TG
SNPdb format
ATATGTCCATTGTCTTTGAGTCTATGTTCGATATACTCAAACAGTCCACC[T/G]
CTTCCTTCAAGATAGAAAGGGGATTCTGGAATCAAACAGCAGTCAACATC
  
Genomic location of solcap_snp_sl_51792  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24191 marker 24191
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)