SGN Marker solcap_snp_sl_51879

SGN-M24204

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69230)
Chromosome
8
Position
8.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65582)
Chromosome
8
Position
10.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60535)
Chromosome
8
Position
3.08 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAACTGCACACTGCATCCTCAAACGAAATAAATACAATGGGTAAAGTA
  
3' flanking region
GTTATCAATCAGAAATTGTCATCTAAAAAAATACTGGCTCCAACAAATCT
SNP nucleotide
AC
SNPdb format
TCAAACTGCACACTGCATCCTCAAACGAAATAAATACAATGGGTAAAGTA[A/C]
GTTATCAATCAGAAATTGTCATCTAAAAAAATACTGGCTCCAACAAATCT
  
Genomic location of solcap_snp_sl_51879  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24204 marker 24204
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)