Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_51907

SGN-M24209

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73379)
Chromosome
8
Position
23.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69233)
Chromosome
8
Position
12.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65585)
Chromosome
8
Position
19.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60540)
Chromosome
8
Position
3.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACAGAGTCATCATTGTTACGAGGTTAGAGAGCATCCTACACAAAGCGGC
  
3' flanking region
TTTCATTCTTTTAGGGGTGGAAGAAAATGTGGTAAGAGTTATAGGACCAT
SNP nucleotide
AC
SNPdb format
AACAGAGTCATCATTGTTACGAGGTTAGAGAGCATCCTACACAAAGCGGC[A/C]
TTTCATTCTTTTAGGGGTGGAAGAAAATGTGGTAAGAGTTATAGGACCAT
  
Genomic location of solcap_snp_sl_51907  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24209 marker 24209
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)