Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_51939

SGN-M24217

Synonyms  
CL015837-0200
CL015837-0200_solcap_snp_sl_51939
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60548)
Chromosome
8
Position
4.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAAGTTTCCTATCTGAAGTACAGAAATCGTTGCTCCTCCGAAAAAGCTT
  
3' flanking region
CCTGACCAACAACAGAAACTCGAAAAGCTAGGGGAAGTTATACACTTCAG
SNP nucleotide
AC
SNPdb format
CAAAGTTTCCTATCTGAAGTACAGAAATCGTTGCTCCTCCGAAAAAGCTT[A/C]
CCTGACCAACAACAGAAACTCGAAAAGCTAGGGGAAGTTATACACTTCAG
  
Genomic location of solcap_snp_sl_51939  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24217 marker 24217
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)