SGN Marker solcap_snp_sl_51969

SGN-M24221

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73382)
Chromosome
8
Position
27.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69236)
Chromosome
8
Position
15.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65588)
Chromosome
8
Position
25.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60552)
Chromosome
8
Position
4.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAACATATTTGAAGTTAAATCAACAATTTTGGTACTAGATGACTACATA
  
3' flanking region
CTGTTAAGGATAAGTTTTTTGTTTTGTGTATGGTTCATTAAGAGATGGAT
SNP nucleotide
TC
SNPdb format
AGAACATATTTGAAGTTAAATCAACAATTTTGGTACTAGATGACTACATA[T/C]
CTGTTAAGGATAAGTTTTTTGTTTTGTGTATGGTTCATTAAGAGATGGAT
  
Genomic location of solcap_snp_sl_51969  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24221 marker 24221
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)