SGN Marker solcap_snp_sl_52197

SGN-M24249

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73403)
Chromosome
7
Position
33.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69249)
Chromosome
7
Position
28.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65600)
Chromosome
7
Position
32.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60580)
Chromosome
7
Position
35.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGCAGATAAACAAATAAGACATCATTTACATCAATATTATTTGATAAGG
  
3' flanking region
TGCTGATTTTTTCTTCTTTGTTTTTCGTGAAAGTGATGTGCAAATAATGA
SNP nucleotide
AG
SNPdb format
AAGCAGATAAACAAATAAGACATCATTTACATCAATATTATTTGATAAGG[A/G]
TGCTGATTTTTTCTTCTTTGTTTTTCGTGAAAGTGATGTGCAAATAATGA
  
Genomic location of solcap_snp_sl_52197  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24249 marker 24249
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)