SGN Marker solcap_snp_sl_52395

SGN-M24278

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73422)
Chromosome
3
Position
50.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69264)
Chromosome
3
Position
45.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65615)
Chromosome
3
Position
49.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60609)
Chromosome
3
Position
47.90 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCTAACTTAAAGCAGAAATGGCACGGTGTTAGACAAGGTTAAAACACAG
  
3' flanking region
TAAGAGAGCCTATAGGGGAGAGTACATCATACAAACAAGATGATTAGAAT
SNP nucleotide
AC
SNPdb format
TGCTAACTTAAAGCAGAAATGGCACGGTGTTAGACAAGGTTAAAACACAG[A/C]
TAAGAGAGCCTATAGGGGAGAGTACATCATACAAACAAGATGATTAGAAT
  
Genomic location of solcap_snp_sl_52395  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24278 marker 24278
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)