SGN Marker solcap_snp_sl_52569

SGN-M24306

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60637)
Chromosome
7
Position
57.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTCCACCCGGCCAAAACCAAAATTACTAGCACCGGTAGCTATAAAATCA
  
3' flanking region
CAAATCTAGCCTTAAATTCTCTCTTGACGCTTCTCCTTCTTCTATAGTCA
SNP nucleotide
TC
SNPdb format
CCTCCACCCGGCCAAAACCAAAATTACTAGCACCGGTAGCTATAAAATCA[T/C]
CAAATCTAGCCTTAAATTCTCTCTTGACGCTTCTCCTTCTTCTATAGTCA
  
Genomic location of solcap_snp_sl_52569  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24306 marker 24306
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)