Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_5260

SGN-M24309

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73440)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69277)
Chromosome
2
Position
2.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65625)
Chromosome
2
Position
4.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60640)
Chromosome
2
Position
20.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCTCATCCTCTCCTAACACAACTTTGCGGGCCTTTAATTTATTTAGGTA
  
3' flanking region
GTTAGCTCCATTCGGAGATATTCTACCCAAAGATCCTCAGAAGTTGGACA
SNP nucleotide
AT
SNPdb format
CCCTCATCCTCTCCTAACACAACTTTGCGGGCCTTTAATTTATTTAGGTA[A/T]
GTTAGCTCCATTCGGAGATATTCTACCCAAAGATCCTCAGAAGTTGGACA
  
Genomic location of solcap_snp_sl_5260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24309 marker 24309
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)