Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_5268

SGN-M24322

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73448)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69282)
Chromosome
2
Position
1.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65630)
Chromosome
2
Position
1.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60653)
Chromosome
2
Position
19.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTAAAAAGGCAGAAAAGGTTTATGTTGTCCTCGCAACTGATGGAAAGTTG
  
3' flanking region
ATAGCGGGGTTGGTCAAAGCCCCATTAAACAAGTTATGGACGATTGTGAT
SNP nucleotide
AT
SNPdb format
CTAAAAAGGCAGAAAAGGTTTATGTTGTCCTCGCAACTGATGGAAAGTTG[A/T]
ATAGCGGGGTTGGTCAAAGCCCCATTAAACAAGTTATGGACGATTGTGAT
  
Genomic location of solcap_snp_sl_5268  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24322 marker 24322
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)