SGN Marker solcap_snp_sl_52697

SGN-M24325

Synonyms  
SGN-U565001_snp1586
SGN-U565001_snp1586_solcap_snp_sl_52697
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70381)
Chromosome
5
Position
6.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66913)
Chromosome
5
Position
8.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63395)
Chromosome
5
Position
7.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60656)
Chromosome
5
Position
1.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGGGAACAAAATTTAGAATGACATTCTACAAATTTTCCGAGCTGTTAG
  
3' flanking region
TGGATCATTTATTCAGTACGAGAAGCTAGAAAAATCTATGGTATCACTGT
SNP nucleotide
TC
SNPdb format
TCTGGGAACAAAATTTAGAATGACATTCTACAAATTTTCCGAGCTGTTAG[T/C]
TGGATCATTTATTCAGTACGAGAAGCTAGAAAAATCTATGGTATCACTGT
  
Genomic location of solcap_snp_sl_52697  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24325 marker 24325
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)