SGN Marker solcap_snp_sl_52710

SGN-M24329

Synonyms  
SGN-U567719_snp239
SGN-U567719_snp239_solcap_snp_sl_52710
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70395)
Chromosome
5
Position
6.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66924)
Chromosome
5
Position
9.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63406)
Chromosome
5
Position
7.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60660)
Chromosome
5
Position
1.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGCAATCTATAATGGCGAAGCGGAACAAAGAGATGAAAGCGGAATCATA
  
3' flanking region
GGCGTAGACATCTGATGAGCTTTAAGGAGACGCCTATTGGTACAAATATC
SNP nucleotide
AG
SNPdb format
ACGCAATCTATAATGGCGAAGCGGAACAAAGAGATGAAAGCGGAATCATA[A/G]
GGCGTAGACATCTGATGAGCTTTAAGGAGACGCCTATTGGTACAAATATC
  
Genomic location of solcap_snp_sl_52710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24329 marker 24329
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)