SGN Marker solcap_snp_sl_52714

SGN-M24330

Synonyms  
SGN-U583136_snp1228
SGN-U583136_snp1228_solcap_snp_sl_52714
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70473)
Chromosome
5
Position
7.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67001)
Chromosome
5
Position
10.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63476)
Chromosome
5
Position
8.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60661)
Chromosome
5
Position
1.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTACCTATTATTAAACAAGCACTTTCACAAGAATACTTATATGGTGCCT
  
3' flanking region
CCACAAGTATAACACGATAGACGAACGAAGTGGAAAACGTGGTTGTCTGT
SNP nucleotide
TG
SNPdb format
TTTACCTATTATTAAACAAGCACTTTCACAAGAATACTTATATGGTGCCT[T/G]
CCACAAGTATAACACGATAGACGAACGAAGTGGAAAACGTGGTTGTCTGT
  
Genomic location of solcap_snp_sl_52714  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24330 marker 24330
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)