SGN Marker solcap_snp_sl_52738

SGN-M24334

Synonyms  
SGN-U563626_snp135
SGN-U563626_snp135_solcap_snp_sl_52738
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70373)
Chromosome
5
Position
8.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66904)
Chromosome
5
Position
12.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60665)
Chromosome
5
Position
1.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAATGGATCATGCATTTTGTTGAAGAGTTGAAAGTAATGACTTGACACC
  
3' flanking region
CTTGATTTGTTGTGTGATTGGCTTCTTGTTAAATTCAGGCCATGTTGGGT
SNP nucleotide
TC
SNPdb format
TAAATGGATCATGCATTTTGTTGAAGAGTTGAAAGTAATGACTTGACACC[T/C]
CTTGATTTGTTGTGTGATTGGCTTCTTGTTAAATTCAGGCCATGTTGGGT
  
Genomic location of solcap_snp_sl_52738  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24334 marker 24334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)