SGN Marker solcap_snp_sl_53169

SGN-M24408

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73499)
Chromosome
9
Position
22.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69310)
Chromosome
9
Position
45.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65658)
Chromosome
9
Position
64.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60739)
Chromosome
9
Position
23.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTACAGAATCGGGACTTTTTGCGGTCTTGCCATGGCTCACAATGGCAG
  
3' flanking region
CACTGCAAATGTTGGTGGGTGGATTGCAGATTCACTGGTGAGGAGAGGCA
SNP nucleotide
TC
SNPdb format
TCTTACAGAATCGGGACTTTTTGCGGTCTTGCCATGGCTCACAATGGCAG[T/C]
CACTGCAAATGTTGGTGGGTGGATTGCAGATTCACTGGTGAGGAGAGGCA
  
Genomic location of solcap_snp_sl_53169  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24408 marker 24408
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)