SGN Marker solcap_snp_sl_53335

SGN-M24421

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73507)
Chromosome
7
Position
55.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69315)
Chromosome
7
Position
43.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65663)
Chromosome
7
Position
55.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60752)
Chromosome
7
Position
59.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTATTTATCCTTAGTTTTTAAAGATGGCTCTTCCCTCTTAAGAGAATAT
  
3' flanking region
TATATGATTTGATGGTGAACTTTCTAGCATTCCGTTTCCAAATCCACCTG
SNP nucleotide
AG
SNPdb format
TCTATTTATCCTTAGTTTTTAAAGATGGCTCTTCCCTCTTAAGAGAATAT[A/G]
TATATGATTTGATGGTGAACTTTCTAGCATTCCGTTTCCAAATCCACCTG
  
Genomic location of solcap_snp_sl_53335  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24421 marker 24421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)