SGN Marker solcap_snp_sl_53692

SGN-M24458

Synonyms  
CL015806-0417
CL015806-0417_solcap_snp_sl_53692
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60789)
Chromosome
1
Position
89.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGCTCCCTTGCCGGAGATTCACTGCCAAATCCGAGTTTCCCACACCAGTG
  
3' flanking region
TACCTCCATTTATGTTCCCGGCGATTGGCGGGAAAGATGTGGTGCTCTGC
SNP nucleotide
TC
SNPdb format
CGCTCCCTTGCCGGAGATTCACTGCCAAATCCGAGTTTCCCACACCAGTG[T/C]
TACCTCCATTTATGTTCCCGGCGATTGGCGGGAAAGATGTGGTGCTCTGC
  
Genomic location of solcap_snp_sl_53692  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24458 marker 24458
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)