Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_53721

SGN-M24460

Synonyms  
SGN-U581138_snp1171
SGN-U581138_snp1171_solcap_snp_sl_53721
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70461)
Chromosome
1
Position
126.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66991)
Chromosome
1
Position
116.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63467)
Chromosome
1
Position
200.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60791)
Chromosome
1
Position
89.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCTGCAGAAAACCTGCAGCAGAGTAAAAACCCAACCCAAATTATTGCCT
  
3' flanking region
TAGAGATTGACCATGGAGGTTAATTTCAATCTGTTGTTCCATTTTAGTTT
SNP nucleotide
CG
SNPdb format
CTCTGCAGAAAACCTGCAGCAGAGTAAAAACCCAACCCAAATTATTGCCT[C/G]
TAGAGATTGACCATGGAGGTTAATTTCAATCTGTTGTTCCATTTTAGTTT
  
Genomic location of solcap_snp_sl_53721  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24460 marker 24460
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)