SGN Marker solcap_snp_sl_53749

SGN-M24462

Synonyms  
SGN-U581283_snp1102
SGN-U581283_snp1102_solcap_snp_sl_53749
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70463)
Chromosome
1
Position
126.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66993)
Chromosome
1
Position
115.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63469)
Chromosome
1
Position
199.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60793)
Chromosome
1
Position
89.63 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAATGAAAAATATGACCAATACTAATAAGGATGATACAAATAAATACAG
  
3' flanking region
ACAGATCCAAGGCTAAGATAAAACTAGCATTACATACAACATAATGAAAG
SNP nucleotide
TC
SNPdb format
GAAATGAAAAATATGACCAATACTAATAAGGATGATACAAATAAATACAG[T/C]
ACAGATCCAAGGCTAAGATAAAACTAGCATTACATACAACATAATGAAAG
  
Genomic location of solcap_snp_sl_53749  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24462 marker 24462
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)