SGN Marker solcap_snp_sl_53903

SGN-M24470

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73535)
Chromosome
12
Position
49.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60801)
Chromosome
12
Position
47.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTAGCACCAATGGCGAGGACAAAGCAAACAGCGAGAAAATCCACCGGAGG
  
3' flanking region
AAGGCACCGAGGAAGCAATTAGCCACCAAAGCTGCAAGGAAATCAGCACC
SNP nucleotide
AG
SNPdb format
TTAGCACCAATGGCGAGGACAAAGCAAACAGCGAGAAAATCCACCGGAGG[A/G]
AAGGCACCGAGGAAGCAATTAGCCACCAAAGCTGCAAGGAAATCAGCACC
  
Genomic location of solcap_snp_sl_53903  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24470 marker 24470
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)