SGN Marker solcap_snp_sl_54

SGN-M24479

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60810)
Chromosome
5
Position
60.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGCGATTCGCGCTTCAGCTGCTGTAGAGACTTTACAGAAAACTGATAAT
  
3' flanking region
CCCTTGTTGAGAAATCTGTAAATACGATCAGATTTTTGGCTATTGATGCT
SNP nucleotide
TG
SNPdb format
CGGCGATTCGCGCTTCAGCTGCTGTAGAGACTTTACAGAAAACTGATAAT[T/G]
CCCTTGTTGAGAAATCTGTAAATACGATCAGATTTTTGGCTATTGATGCT
  
Genomic location of solcap_snp_sl_54  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24479 marker 24479
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)