SGN Marker solcap_snp_sl_54052

SGN-M24487

Synonyms  
SGN-U580217_snp1440
SGN-U580217_snp1440_solcap_snp_sl_54052
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70453)
Chromosome
9
Position
22.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60818)
Chromosome
9
Position
49.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATACAATGCAAGTTTATTGAGGATTTAGTTTATGAAATGAAGGACATGGC
  
3' flanking region
AAGATCTCAACTAACTAGCTATGATATGTGATATGTCTCACTACCGCGAT
SNP nucleotide
TC
SNPdb format
ATACAATGCAAGTTTATTGAGGATTTAGTTTATGAAATGAAGGACATGGC[T/C]
AAGATCTCAACTAACTAGCTATGATATGTGATATGTCTCACTACCGCGAT
  
Genomic location of solcap_snp_sl_54052  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24487 marker 24487
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)